ID: 946202802_946202817

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 946202802 946202817
Species Human (GRCh38) Human (GRCh38)
Location 2:218080743-218080765 2:218080788-218080810
Sequence CCATCAGCATCCTTCCCTCCCTC GCACCAGTGCCAGGAATCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 176, 4: 1517} {0: 1, 1: 0, 2: 1, 3: 19, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!