ID: 946221907_946221912

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 946221907 946221912
Species Human (GRCh38) Human (GRCh38)
Location 2:218234972-218234994 2:218235003-218235025
Sequence CCTTTTTACCCTGTGATTCAGTG CAAATTCTGAGGCATTTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 265} {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!