ID: 946221910_946221912

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 946221910 946221912
Species Human (GRCh38) Human (GRCh38)
Location 2:218234981-218235003 2:218235003-218235025
Sequence CCTGTGATTCAGTGGCATGTCTC CAAATTCTGAGGCATTTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129} {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!