ID: 946226607_946226621

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 946226607 946226621
Species Human (GRCh38) Human (GRCh38)
Location 2:218267217-218267239 2:218267270-218267292
Sequence CCTTCCCCCTTCTGTCCACTCTA TGGCCTTCTCTGGCCTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 50, 4: 630} {0: 1, 1: 2, 2: 5, 3: 30, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!