ID: 946229046_946229057

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 946229046 946229057
Species Human (GRCh38) Human (GRCh38)
Location 2:218280373-218280395 2:218280405-218280427
Sequence CCACGCCACTGGGGGTTCACTGG ATGTAGTGGGGAAGCCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92} {0: 1, 1: 0, 2: 0, 3: 19, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!