ID: 946229052_946229058

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 946229052 946229058
Species Human (GRCh38) Human (GRCh38)
Location 2:218280378-218280400 2:218280411-218280433
Sequence CCACTGGGGGTTCACTGGGGGGT TGGGGAAGCCAGGCAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 141} {0: 1, 1: 1, 2: 5, 3: 95, 4: 814}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!