ID: 946229631_946229638

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 946229631 946229638
Species Human (GRCh38) Human (GRCh38)
Location 2:218283285-218283307 2:218283302-218283324
Sequence CCCAGAACCCCAGAACTCGCAGG CGCAGGTCAGTGGCATAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 170} {0: 1, 1: 0, 2: 1, 3: 20, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!