ID: 946230334_946230341

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 946230334 946230341
Species Human (GRCh38) Human (GRCh38)
Location 2:218287311-218287333 2:218287341-218287363
Sequence CCGCCCACTCTCTGAGTGATAGA ACACACCCTCTCCCAAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 136} {0: 1, 1: 0, 2: 2, 3: 24, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!