ID: 946297124_946297126

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 946297124 946297126
Species Human (GRCh38) Human (GRCh38)
Location 2:218794120-218794142 2:218794138-218794160
Sequence CCCTGGTACGGGAGAGGACAAGC CAAGCTCCTCCCTCTGCAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80} {0: 1, 1: 1, 2: 10, 3: 35, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!