ID: 946301727_946301734

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 946301727 946301734
Species Human (GRCh38) Human (GRCh38)
Location 2:218828145-218828167 2:218828166-218828188
Sequence CCAGTGTCCTTGTGCTGAGACAC ACAGTGGGGACTGTGGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 185} {0: 1, 1: 0, 2: 3, 3: 36, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!