ID: 946301727_946301738

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 946301727 946301738
Species Human (GRCh38) Human (GRCh38)
Location 2:218828145-218828167 2:218828187-218828209
Sequence CCAGTGTCCTTGTGCTGAGACAC GGACAGTGGGGCAGCCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 185} {0: 1, 1: 0, 2: 1, 3: 30, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!