ID: 946307722_946307744

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 946307722 946307744
Species Human (GRCh38) Human (GRCh38)
Location 2:218865692-218865714 2:218865745-218865767
Sequence CCCCTGTCCCACCCTCAGATAGG GGCCCAGGACAGTCTCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 223} {0: 1, 1: 1, 2: 4, 3: 45, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!