ID: 946308800_946308824

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 946308800 946308824
Species Human (GRCh38) Human (GRCh38)
Location 2:218871607-218871629 2:218871649-218871671
Sequence CCTCCCCGGCCCTCCGGCCTGCC GGCCCCGCGGGCTCCCCGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 95, 4: 900} {0: 1, 1: 0, 2: 0, 3: 25, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!