ID: 946308805_946308824

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 946308805 946308824
Species Human (GRCh38) Human (GRCh38)
Location 2:218871616-218871638 2:218871649-218871671
Sequence CCCTCCGGCCTGCCCGGCACCCC GGCCCCGCGGGCTCCCCGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 420} {0: 1, 1: 0, 2: 0, 3: 25, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!