ID: 946311026_946311037

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 946311026 946311037
Species Human (GRCh38) Human (GRCh38)
Location 2:218882754-218882776 2:218882801-218882823
Sequence CCTCTGCTTAGTAAACCACATTT ACCCAGAATCAGCATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 195} {0: 1, 1: 0, 2: 1, 3: 18, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!