ID: 946329936_946329944

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 946329936 946329944
Species Human (GRCh38) Human (GRCh38)
Location 2:219003235-219003257 2:219003259-219003281
Sequence CCAGCAGCGCCTCCTGCAGGTTG CGAAGGCCGGGAGCCTGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 311} {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!