ID: 946337656_946337668

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 946337656 946337668
Species Human (GRCh38) Human (GRCh38)
Location 2:219049361-219049383 2:219049413-219049435
Sequence CCAGCTGGGCAGAAGGCCCAGCT GCAGCAGGTGTGACTCAGGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 28, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!