ID: 946342523_946342529

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 946342523 946342529
Species Human (GRCh38) Human (GRCh38)
Location 2:219080086-219080108 2:219080130-219080152
Sequence CCTGGGTCTAAATGTGGAACCTA TTCCCCTTCTCAGAGAGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91} {0: 1, 1: 0, 2: 3, 3: 15, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!