ID: 946359927_946359932

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 946359927 946359932
Species Human (GRCh38) Human (GRCh38)
Location 2:219213142-219213164 2:219213169-219213191
Sequence CCAGGCTCTTTTCCAAAAGCAGG CAGAGCACTGAGAAGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 338} {0: 1, 1: 0, 2: 3, 3: 78, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!