ID: 946361073_946361081

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 946361073 946361081
Species Human (GRCh38) Human (GRCh38)
Location 2:219219648-219219670 2:219219661-219219683
Sequence CCAGCCCGGTCTGTCCCATGTGC TCCCATGTGCAGGTGATGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135} {0: 2, 1: 0, 2: 1, 3: 43, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!