ID: 946362846_946362856

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 946362846 946362856
Species Human (GRCh38) Human (GRCh38)
Location 2:219229435-219229457 2:219229467-219229489
Sequence CCTCCGTTACCCGCCGCGAGCTC TCCGCAGGCACCCCTGGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42} {0: 1, 1: 0, 2: 0, 3: 23, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!