ID: 946362852_946362861

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 946362852 946362861
Species Human (GRCh38) Human (GRCh38)
Location 2:219229448-219229470 2:219229478-219229500
Sequence CCGCGAGCTCACTTAGGGCTCCG CCCTGGGCAAGGCCAGACACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 53} {0: 1, 1: 1, 2: 3, 3: 40, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!