ID: 946369374_946369387

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 946369374 946369387
Species Human (GRCh38) Human (GRCh38)
Location 2:219271306-219271328 2:219271354-219271376
Sequence CCCAGCCCCCCAGGTGTCTACAG CCTGACCACCCACACCACCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 23, 4: 185} {0: 2, 1: 8, 2: 8, 3: 38, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!