ID: 946374144_946374154

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 946374144 946374154
Species Human (GRCh38) Human (GRCh38)
Location 2:219298010-219298032 2:219298057-219298079
Sequence CCACACCTGCCAGGGCCACCAGA GAGGTGCTGTGCGCAGTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 407} {0: 1, 1: 0, 2: 1, 3: 11, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!