ID: 946385439_946385441

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 946385439 946385441
Species Human (GRCh38) Human (GRCh38)
Location 2:219381560-219381582 2:219381581-219381603
Sequence CCGGTGGTTCTCCTCATGCTTGT GTCCCTGTAAGAGACAGATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166} {0: 1, 1: 1, 2: 6, 3: 67, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!