|
Left Crispr |
Right Crispr |
| Crispr ID |
946385974 |
946385992 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:219384813-219384835
|
2:219384864-219384886
|
| Sequence |
CCCCGCCTCAGCCTCCCAAAGTG |
CAGAGATTGGAGAAGGGGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 359, 1: 2122, 2: 3966, 3: 5053, 4: 7578} |
{0: 1, 1: 1, 2: 4, 3: 66, 4: 607} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|