|
Left Crispr |
Right Crispr |
Crispr ID |
946385982 |
946385992 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:219384828-219384850
|
2:219384864-219384886
|
Sequence |
CCAAAGTGCTGGGATTCCTTGCT |
CAGAGATTGGAGAAGGGGGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 7, 2: 223, 3: 11469, 4: 246665} |
{0: 1, 1: 1, 2: 4, 3: 66, 4: 607} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|