ID: 946392698_946392705

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 946392698 946392705
Species Human (GRCh38) Human (GRCh38)
Location 2:219426131-219426153 2:219426157-219426179
Sequence CCTCGTGGTCCCCAACAGCGACA CCCATCCCTGCCTGGTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 48} {0: 1, 1: 0, 2: 2, 3: 28, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!