ID: 946407581_946407591

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 946407581 946407591
Species Human (GRCh38) Human (GRCh38)
Location 2:219500005-219500027 2:219500020-219500042
Sequence CCCTCAAAAGGGTGAGGTGCCAG GGTGCCAGGGGAATGGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167} {0: 1, 1: 3, 2: 4, 3: 87, 4: 924}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!