ID: 946410301_946410311

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 946410301 946410311
Species Human (GRCh38) Human (GRCh38)
Location 2:219512183-219512205 2:219512217-219512239
Sequence CCGCATGCCCCTTATACCCAGTT TCTTTCCTTATAGAGGTTGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!