ID: 946413123_946413126

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 946413123 946413126
Species Human (GRCh38) Human (GRCh38)
Location 2:219525653-219525675 2:219525675-219525697
Sequence CCTGGAAAGGATAGGGAAGGAAG GAGGCTTTGAACCTGGATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 465} {0: 1, 1: 0, 2: 0, 3: 22, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!