ID: 946415230_946415244

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 946415230 946415244
Species Human (GRCh38) Human (GRCh38)
Location 2:219536879-219536901 2:219536922-219536944
Sequence CCCCTCAAAAGATGAAGCTAACA CTCACAGCCTTGGGGAGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 179} {0: 1, 1: 0, 2: 2, 3: 24, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!