ID: 946416407_946416416

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 946416407 946416416
Species Human (GRCh38) Human (GRCh38)
Location 2:219542170-219542192 2:219542209-219542231
Sequence CCGTGCTGATGTAGCGGGTCCTA AAGCTTATCAAAAGGACAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39} {0: 1, 1: 0, 2: 0, 3: 21, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!