ID: 946417700_946417702

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 946417700 946417702
Species Human (GRCh38) Human (GRCh38)
Location 2:219548832-219548854 2:219548855-219548877
Sequence CCAGTGAAGAAGCAGCTGTGATT GTCCAGTGGAAAGATGATGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 263} {0: 1, 1: 0, 2: 5, 3: 59, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!