ID: 946428523_946428532

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 946428523 946428532
Species Human (GRCh38) Human (GRCh38)
Location 2:219612769-219612791 2:219612815-219612837
Sequence CCTGTGTCTGCCAAGGAGTTTGG AGCCACTGAAGGATTTGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 217} {0: 1, 1: 0, 2: 7, 3: 69, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!