ID: 946481278_946481282

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 946481278 946481282
Species Human (GRCh38) Human (GRCh38)
Location 2:220059191-220059213 2:220059220-220059242
Sequence CCTGGGTTTGAGCAATTTTCCTG CCTCCTCAGCACCTGTAGCTAGG
Strand - +
Off-target summary {0: 6, 1: 170, 2: 2773, 3: 40856, 4: 115965} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!