ID: 946612004_946612005

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 946612004 946612005
Species Human (GRCh38) Human (GRCh38)
Location 2:221468868-221468890 2:221468906-221468928
Sequence CCACTATGGTTGTTGTCATCTTG TAACTAATTCAGAAGTGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118} {0: 1, 1: 0, 2: 1, 3: 13, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!