ID: 946618820_946618828

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 946618820 946618828
Species Human (GRCh38) Human (GRCh38)
Location 2:221539085-221539107 2:221539129-221539151
Sequence CCAAGTTCAAGGTCCTGACACAG GTAGCAGCAGTAGCAGGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 288} {0: 1, 1: 0, 2: 4, 3: 117, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!