ID: 946622432_946622452

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 946622432 946622452
Species Human (GRCh38) Human (GRCh38)
Location 2:221573549-221573571 2:221573599-221573621
Sequence CCCTTCCCAGGCCGCCCCTCCTC TTCCTGGGGAGCCTGGGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 84, 4: 816} {0: 1, 1: 0, 2: 3, 3: 41, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!