ID: 946629899_946629901

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 946629899 946629901
Species Human (GRCh38) Human (GRCh38)
Location 2:221655798-221655820 2:221655817-221655839
Sequence CCAAATGCTCCAGTAATTTAGAT AGATTCGCTATGATACCACGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!