ID: 946632922_946632931

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 946632922 946632931
Species Human (GRCh38) Human (GRCh38)
Location 2:221690802-221690824 2:221690853-221690875
Sequence CCTCCCTTGTTGTATCAGAAAGA TGGCAGAGCCAAAGTAGGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 24, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!