ID: 946668651_946668654

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 946668651 946668654
Species Human (GRCh38) Human (GRCh38)
Location 2:222078155-222078177 2:222078195-222078217
Sequence CCACTGAGTATTTCAATTATTTG AAGCTGTAATTGTTGAGACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!