ID: 946702086_946702097

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 946702086 946702097
Species Human (GRCh38) Human (GRCh38)
Location 2:222424430-222424452 2:222424458-222424480
Sequence CCTGGGCGGGCGCTAGGACCCGG GCACCTGTTGGCTGGGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 148} {0: 1, 1: 0, 2: 2, 3: 19, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!