ID: 946702098_946702123

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 946702098 946702123
Species Human (GRCh38) Human (GRCh38)
Location 2:222424461-222424483 2:222424511-222424533
Sequence CCTGTTGGCTGGGCCCGGGGCCC GGGATCGGCGGGGGCGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 325} {0: 1, 1: 0, 2: 1, 3: 53, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!