ID: 946702101_946702121

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 946702101 946702121
Species Human (GRCh38) Human (GRCh38)
Location 2:222424475-222424497 2:222424507-222424529
Sequence CCGGGGCCCCGCCCGCCCGGCCT GTGCGGGATCGGCGGGGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 118, 4: 866} {0: 1, 1: 0, 2: 1, 3: 34, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!