ID: 946702103_946702118

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 946702103 946702118
Species Human (GRCh38) Human (GRCh38)
Location 2:222424482-222424504 2:222424501-222424523
Sequence CCCGCCCGCCCGGCCTCCGCCCG CCCGGAGTGCGGGATCGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 123, 4: 972} {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!