ID: 946759086_946759098

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 946759086 946759098
Species Human (GRCh38) Human (GRCh38)
Location 2:222975347-222975369 2:222975383-222975405
Sequence CCACCGCACCTGCCCCCCCCTTT ATTTGGTGGCTAAATGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 196, 4: 1687} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!