ID: 946843697_946843701

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 946843697 946843701
Species Human (GRCh38) Human (GRCh38)
Location 2:223840697-223840719 2:223840712-223840734
Sequence CCTGGCCTGGCTGAGATGGGCAG ATGGGCAGAGGATGCTCTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 28, 4: 533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!