ID: 946865636_946865645

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 946865636 946865645
Species Human (GRCh38) Human (GRCh38)
Location 2:224039198-224039220 2:224039250-224039272
Sequence CCAAGCGGCGGCGGCGAGGAGGG CTGCAGACGCCGCGCAGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 270} {0: 1, 1: 0, 2: 0, 3: 26, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!