ID: 946882061_946882067

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 946882061 946882067
Species Human (GRCh38) Human (GRCh38)
Location 2:224186197-224186219 2:224186236-224186258
Sequence CCGAAAGGGCAGAGGGTTATATT ATGCAGGATGGTGAGAGGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 49, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!